Australian Aboriginal Culture Essay

Introduction Aboriginals or indigenous Australians are the native people of Australia. Aboriginals were nomadic people who came to Australia about 40,000 – 60,000 years ago from Southeast Asia. Religion is a great part of Aboriginal culture. The essay answers these questions: What do Aboriginals belief? What is a Kinship system? What is Dreaming and Dreamtime? What rituals does Aboriginals have? Religion The Aborigines have a complex belief in creation, spirits and culture that gives a definite distinctiveness from any other religion in the world. Thousands of years ago, Australian Aboriginal people were living in accordance with their dreamtime beliefs- today, a majority of the Aboriginal community profess allegiance to Christianity, and only 3% still adhere to traditional beliefs. These beliefs have provided the Aboriginal people with guidance and perspective on all aspects of life. There were many variants to these beliefs and practises throughout the many Aboriginal tribal areas, but all Aboriginal people have developed an intimate relationship between themselves and their environment. They see themselves as spiritually bound to the natural world. The Dreamtime The Dreamtime specifically refers to the period of time when the creators made the territory of a tribe and all it contained. It was a period when patterns of living were established and laws were laid down for human beings to follow. The Dreamtime is linked with many aspects of Aboriginal practise, including rituals, storytelling and Aboriginal lore. Artwork Traditional Aboriginal art was inspired by religious ceremonies or rituals. Modern Aboriginal art is a vital part of the world’s oldest continuous cultural tradition. It is also one of the most brilliant and exciting areas of modern art. It is based on animals or patterns. All the designs, painted or drawn, have a story behind them. Many of the Dreamtime stories are told using artwork because there were so many different aboriginal languages in every region that the people couldn’t understand people from the other tribes. Language Groups There are about 150 existing language groups this day, the number of the groups has been decreasing rapidly after the Europeans came to Australia. In Aboriginal culture the language isn’t only a form of communication, it is used to mark territory. It is possible that people from tribe only fifty kilometres away cannot understand the other tribes language at all. Aboriginal Language groups (http://www. ewb. org. au/images/uploads/2010challenge/Language%20Map. jpg) Elders Certain senior male members of traditional language groups may become Elders. Elders are initiated men who are selected to be ritual leaders upon the basis of their personal qualities such as bravery and compassion and their knowledge of the Law. Elders provide leadership in matters affecting the group, including dispute resolution, educating the young and advising on marriage partners. In traditional Aboriginal society the advice of the Elders is usually unquestioned. Elders assume responsibility for sacred objects, spiritual matters and the performance of ritual. The Elders are vested with custodianship of the Law. Their duty is to honour and maintain the Law, and pass it down to the next generation. Elder(http://www. digital-photo. com.au/gallery/d/4113-1/Aboriginal-Elder-Cedric-Playing-Sticks-IMG_4397. jpg) Kinship System In traditional Aboriginal society inter-personal relationships are governed by a Complex system of rules, known as the classificatory system of kinship. The kinship system is based upon an expanded concept of family, and a concomitant extension of family rights and obligations. The kinship system enables each person in a language group to ascertain precisely where he or she stands in relation to every other person in that group and to Persons outside that group. By providing a mental map of social relationships, each person knows precisely how to behave in relation to every other person. Adulthood When children approach puberty they are required to undergo ritual initiation processes. When a girl reaches her puberty she will be initiated into womanhood, which means she has to start doing the same things than the other women in the camp. She can become a food gatherer, sexual partner or she can start taking care of the young children or the elders. When a girl reaches her womanhood she will go through ritual acts what are body-painting, ornamentation and body-cleansing. When boy approaches puberty he is physically removed from his family to life for an extended period away from the group. The people in the group are forbidden to say the boys name during this period of time. The boy is taught the rights and duties of a adult male. The boy will also learn the secrets of the sacred laws. Before becoming man, the boy’s worthiness and courage will be tested. These tests include piercing the body or circumcision and sleep deprivation. After these rituals the person can get married. Marriage. In traditional Aboriginal society marriages are very important. Marriage can be decided when the bride is very young or sometimes even unborn. Usually man is in his thirties when he gets married. Women can be many years younger than the man, but may have been married before and widowed because the earlier husband has died. Death and after life The aboriginal people took a great amount of care to ensure that a deceased spirit could find its’ way to the sky or a ‘spirit-place’, by sitting by the person’s grave and mourning. After death, the relatives took a number of precautions against the deceased person’s spirit returning to their camp. This involved them in taking a zigzag course to the burial ground to trick the deceased spirit about the direction back to their camp. After a death, some tribes beat their bodies with sticks or clubs, or cut themselves with shells or stone knives to cause bleeding. In these instances, the period of sorrow or mourning was considered to be at an end when their wounds were healed. After the mourning period was completed, it was disrespectful to say the dead person’s name in some time, the time depended how the person had died. The people also believed that a person’s spirit could visit living people to harm or warn them of danger. This usually resulted in an inquiry about the death of a person who was considered to have died too early or in unusual way. Funeral Totems (http://nursing322fall09. files. wordpress. com/2009/11/funeral-totems. jpg) References: http://www. indigenousaustralia. info http://fi. wikipedia. org/wiki/Aboriginaali http://en. wikipedia. org/wiki/Indigenous_Australians.

Relative Rates: Free-Radical Bromination

BroIn this experiment of the relative rates of free-radical chain bromination, we were expected to be able to determine the relative reactivates of the many types of hydrogen atoms involved toward bromine atoms. Bromination is defined to be a regioselective reaction meaning bromine has preference of making or breaking a bond over all other directions that it may have had available.In this case, Markovnikov’s rule is revealed to be the case in this situation that states that adding a protic acid represented as HX to an alkene (sp2 hybridized), the hydrogen from that HX would be attracted to a carbon with the least alkyl groups and the halide (X) would become more attracted and will attach to the carbon containing more alkyl groups. Within the intermediate stage of the bromination reaction, the bromine radical will have already formed and the electronegatively charged radical will have a choice of how to protonate in order to create a stable carbocation.In order to determine the se sp3 hybridized carbons stability, it can be determined by knowing that while comparing, if there are less alkyl groups attached to a carbocation, then there would not be enough electrons to slightly mask over the positive charge on that certain carbocation. Due to this, the more alkyl groups that are attached, the more stable the carbocation would be due to the fact that the electron flow in the electron cloud slightly donates to the carbocation making it almost completely stable.During the experiment, we were expected to organize two groups of tubes with methylene chloride with their respective hydrocarbon (10 drops) as well as the addition of a small amount of bromine. One group of tubes was set in the light and one was set in the dark and when compared, you were already able to see that the ethylbenzene and toluene were the fastest to react in both situations.Due to this fact we can tell since they were the fastest reacting, they can be associated with the fact that they were more than likely secondary and primary benzylic carbons due to their excellent stability and fast reactions. The only other tube that reacted through observation (by eye) by the end of the experiment was the methylcyclohexane; and we could tell that it had slightly reacted by it’s slight orange color, but was not still completely red like the others(sign of bromine).The next most stable carbocation form would be the tertiary aliphatic carbon, so we will infer that this is what has occurred in this case. Due to the fact that methylcyclohexane is sp3 hybridized, we can pin point that our assumption that the bromination is tertiary aliphatic because it is stable with there being three alkyl groups present which means that the electrons within these groups are delocalized and are contained within an orbital that extends over the adjacent atoms involved. The last two tubes to react within the group were cyclohexane and t-butylbenzene in that order.When first added the bromine, the se two were the only ones that seemed to remain red longer and remained the same shade of red even after all of the other tubes had reacted. The reaction of cyclohexane however was expected to react slightly more than the t-butylbenzene due to the fact that the positive charge on the carbocation is delocalized â€Å"better† when there are more alkyl groups involved. This will match up the two with secondary (cyclohexane) and primary aliphatic (t-butylbenzene) bromination.

Life in the Past and Life Now-Comparison.

Life in the past and life now-comparison. Over the last century, there have been many significant changes in the way we live. Obviously, it is hard to compare the life of the ancient people and the life of the people of the twenty first century because so many changes have occurred. However, even the changes that have taken place over the last ten years are amazing. To start with, people were not able to travel such long distances in such short period of time. The planes were not that popular then because they used to be a very expensive means of transport.Nowadays, we have become very mobile. We have fast and comfortable cars and more and more people also travel by plane. Moreover, in the past people had to work much harder as they did not have tools which made their work easier. Today, most of the difficult and dangerous work is done by computers and other machines. In the past the conditions of living were not as comfortable as they are now. There were not bathrooms and running wa ter in many houses, besides many people could not afford household appliances like fridge, TV set or vacuum cleaner because they used to be luxurious goods.Another difference between living now and in the past is the fact that nowadays the access to education is much easier. In the past, there were fewer schools and the quality of the education they provided was much poorer. Besides, nowadays it is much easier to find the educational materials that you need thanks to the Internet. Another difference is that in the past there were not that many sources of entertainment. Therefore people used to spend more time with their friends.All things considering, it is an obvious conclusion that life has changed significantly in the last couple of years. It is definitely much easier now however, it is not easy to decide whether it is also better. The scientific achievements and technological progress are amazing. We still create new inventions which simplify our lives. On the other hand, howeve r, life now is much faster and busier than it used to be in the past. Moreover, it has also become more dangerous. The standard of living has definitely improved but it can be discussed whether the quality of our lives is also better. Life in the Past and Life Now-Comparison. Life in the past and life now-comparison. Over the last century, there have been many significant changes in the way we live. Obviously, it is hard to compare the life of the ancient people and the life of the people of the twenty first century because so many changes have occurred. However, even the changes that have taken place over the last ten years are amazing. To start with, people were not able to travel such long distances in such short period of time. The planes were not that popular then because they used to be a very expensive means of transport.Nowadays, we have become very mobile. We have fast and comfortable cars and more and more people also travel by plane. Moreover, in the past people had to work much harder as they did not have tools which made their work easier. Today, most of the difficult and dangerous work is done by computers and other machines. In the past the conditions of living were not as comfortable as they are now. There were not bathrooms and running wa ter in many houses, besides many people could not afford household appliances like fridge, TV set or vacuum cleaner because they used to be luxurious goods.Another difference between living now and in the past is the fact that nowadays the access to education is much easier. In the past, there were fewer schools and the quality of the education they provided was much poorer. Besides, nowadays it is much easier to find the educational materials that you need thanks to the Internet. Another difference is that in the past there were not that many sources of entertainment. Therefore people used to spend more time with their friends.All things considering, it is an obvious conclusion that life has changed significantly in the last couple of years. It is definitely much easier now however, it is not easy to decide whether it is also better. The scientific achievements and technological progress are amazing. We still create new inventions which simplify our lives. On the other hand, howeve r, life now is much faster and busier than it used to be in the past. Moreover, it has also become more dangerous. The standard of living has definitely improved but it can be discussed whether the quality of our lives is also better.

Critically discuss the view that capital markets created the Essay - 3

Critically discuss the view that capital markets created the conditions that led to the new economy bubble and the banking crisis - Essay Example This is attributed to the fact that when a firm or a nation borrows money from the capital markets, the reason is often to invest in additional physical capital products that will be utilized to increase income. It usually takes several months or even years before the investments start generating sufficient return to pay back its cost thus leading to an economic crisis. Capital markets are usually concerned with long tern finance. It comprises of a series of channels through which the communities’ savings are made available for commercial and industrial enterprises and public authorities. Therefore, Chisholm (2009) defines capital markets as financial markets which are tasked with the buying and selling of equity-backed securities or long-term debt. These markets usually channel the wealth of the savers to those who have the capability of putting it into long-term use. The paper will offer evidence supporting the view that capital markets created the conditions that led to the ‘new economy’ bubble and the banking crisis. According to a view shared by Rudd (2009), prescriptions of the neo-liberal policy flow from the major theoretical belief in the superiority of unregulated markets, especially unregulated capital markets. These claims is based on the "efficient-markets hypothesis" , which claims that financial-market prices, such as stock-market prices incorporates all the available information representing the best possible estimate of asset prices. Therefore, it follows that if prices fully informed and markets are fully efficient, there exists no reason to believe that asset-price bubbles are probable which means that if these do occur, markets will self-correct. In the neo-liberal view, deviations from market efficiency are as a result of external causes. They ascertain that bubbles and other disruptions are caused by governments and other "imperfections", and

Media Research - Discussion Essay Example | Topics and Well Written Essays - 500 words

Media Research - Discussion - Essay Example The focus of the most desired effects studies would be on the content of video games as a mass media format and how it impacts youth personality and behavior. A recent study identified that the content of violent video games maintains the ability to lower player empathy toward others, in a survey of 307 adolescents between fourth and sixth grade (Funk, Baldacci, Pasold & Baumgardner, 26). It was cited as the â€Å"creative nature† of these games, accompanied with violent content, that changed how young individuals in society can lose their sense of compassion and kindness toward others with routine exposure (Funk, et al, 26). As identified, many varieties of this type of mass media contain advertising imagery that also alters attitudes and lifestyle focus, making effects studies absolutely fascinating. Offers one psychologist, â€Å"regular exposure to games actually rewires a child’s brand, making them more amenable to violence† (gamepolitics.com, 1). This, again, is why effects studies would be so critically important to understanding the role of different mass media formats on human behavior as they actually manage to create bio-physical changes to the human brain. Since there are many different formats of mass media other than video games, effects studies on all types of media could determine whether actual brain restructuring could be a potential and common outcome as a reason for why people change their attitudes and social behaviors. Effects studies related to video game media could be expanded to include the potential for television, radio and the social media found on the Internet to determine whether bio-physical changes occur after routine exposure to multiple media sources. By taking a larger sample of individuals who are not only children but include multiple demographics with different socio-economic backgrounds, actual brain measurements can be taken to witness whether structural changes occur after constant exposure to

A Danger to Fourth Amendment Rights Essay Example | Topics and Well Written Essays - 250 words

A Danger to Fourth Amendment Rights - Essay Example This created controversy, where many individuals claimed that the Supreme Court did not follow the fourth amendment and increased the tension with minority communities (Deborah, 1997). Terry v Ohio (1962), addressed a number of reasonsin seizure and search activities. The court decided that it was legal for police to frisk, question and stop any person whom the law enforcement officers believed that he was acting suspiciously. This is referred to a lower standard than what the fourth amendment refers to a probable cause. Deborah (1997) claims that such frisking and question is against the Fourth Amendment rights while majority think that allowing seizures and searches was a serious blow against the fourth amendment, because it is less than a probable cause. Many seizures and searches are based on probable cause, and the Supreme Court has approved those that are suspicious. This was a serious blow to the Fourth Amendment because all these searches were based on less than a probable cause, while the amendment requires that all searches and seizures should have a probable cause. Additionally, the majority should have adopted Justice Douglas position because he disagrees with the court decision, and contends that the Fourth Amendment entails that every search and seizure to have a probable cause. He also goes ahead and explains that when the court decides to have an exception, then the Americans will lose their protection of privacy. However, despite his concern, Terry v Ohio (1962) law remains. Police are still allowed to question and frisk individuals who look suspicious without any reason or cause to believe they are involved in

Second Life When One Isn't Enough Essay Example | Topics and Well Written Essays - 500 words

Second Life When One Isn't Enough - Essay Example The one essential reason for the popularity of Second Life is that it offers virtual, three dimensional platforms where the residents can challenge and break rules, without the fear of any dire consequences or the apprehension of causing harm to oneself or somebody else. Moreover, the basic landscape of Second Life is same as that of the real world. The only difference is that the residents here can alter and bend their ambience and lifestyle, as per their choice and mood. 2. Some people are very right in believing that Second Life is not a game but a real life experience. One, as already said, the predominant landscape and aspirations in Second Life are somewhat if not totally akin to the real world. Only the laws governing this landscape and aspirations are pliable to human will. The second reason for the life like experience of Second Life is psychological. A thing is real because it is perceived by a person to be so. For example, a chair exists because it could be perceived and f elt by the mind of a person. If a person is blind, one’s mind may not perceive it to be real or present, unless one is allowed to touch it.

Historical Beginnings And Expansion Of Christianity Throughout The Research Paper

Historical Beginnings And Expansion Of Christianity Throughout The Roman Empire - Research Paper Example The early church period encompassed not only the birth and death of Jesus but the historical beginnings and expansion of Christianity throughout the Roman Empire. This was a time when the Christian faith and the Kingdom of God were in question and disbelieved by many Jews. According to Shelley â€Å"The Jews, who represented only half the population, despised their foreign overlords and deeply resented the signs of pagan culture in the accent homeland. The Romans were not just another in a long series of alien conquerors. They were representatives of a hated way of life. Their imperial reign brought to Palestine the Hellenistic (Greek) culture that the Syrians had tried to impose forcibly on the Jews over a century before†. It was evident that change was forthcoming and was imperative in the reduction of resentment, anger, and hostility felt by many. It was during the first forty years of the early church period when Jesus and his apostles embarked on a journey to disseminate and distribute the word of God and the practice of Christianity. During this period of time, Jesus not only conveyed God’s unending love and eternal life to those who believed but most importantly he strived to achieve the trust and acceptance of the non-believers. He inspired and encouraged those, not only through his doctrine and sermons but most notably by his own faithfulness, commitment, and devotion. Ultimately his death and resurrection were the essential components supporting the Christianity movement, and the word of God.

Time Management Matrix-Leadership Essay Example | Topics and Well Written Essays - 500 words

Time Management Matrix-Leadership - Essay Example As such, the time management matrix may arguably be considered an effective time management resource thereby invoking the importance of its analysis. The first quadrant comprises of urgent and important items such as a crying baby and some calls. This implies that items in the first quadrant require immediate attention and cannot be postponed. The second quadrant is a composition of not urgent but important items such as exercise and vacation. Items in the second quadrant may be regarded long term due to their lack of urgency but should not be neglected. According to Covey, items in the second quadrant are somewhat neglected, perhaps, because they are not urgent. Nonetheless, it important to note that efficacy is achieved by working both strategically and tactically and items in quadrant two ensure this. For example, exercising is not urgent but it is an important aspect of healthy living. The third quadrant entails items that are urgent but may be regarded as not important such as other calls. This implies that quadrant three items could be eliminated but people feel the need to hold on to them. As such, these items consume the largest portion of people’s time thereby corrupting effective time management. Finally, the fourth quadrant is a composition of items that are neither important nor urgent such as trivia. Quadrant four items are generally those that people take as breaks from important activities hence they can be considered to add relatively little value. Therefore, quadrant four items may be eliminated in an effort to avoid wasting time. The time management matrix arguably provides a proper strategy of managing time effectively hence can be useful tool in leadership. After analyzing and comprehending the application of time management matrix, leaders should take time to categorize their different commitments into respective quadrants. Additionally, after categorizing commitments, calculations of percentage of

Rawls Theory of Justice Essay Example | Topics and Well Written Essays - 750 words

Rawls Theory of Justice - Essay Example Furthermore, in the theory of justice Rawls attempts to resolve the utilitarian and deontological approach to ethics by arguing with the Kantian social contract model. However, Rawls recognized that the justice as fairness is based in the Kant's notion of autonomy. Rawls goes further and explain theory of justice as the original position principle where the justice based in the veiled ignorance, according to Rawls "no one knows his place in society his class position or social status" (Rawls, 1999 (ed), p.118). In the theory of justice Rawls support the element of the Kantian social contract philosophy, Rawls does agree with Kant's ideal of cosmopolitan constitution in term of cosmopolitan theory of justice. This essay will answer the question by critically evaluate Rawls' theory in relation to the cosmopolitan theory of justice, first of all I have to evaluate the core elements of Rawls' theory of justice and than I have to analyses these elements with leading to the cosmopolitan justice theory ( Rawls, translated by Michelle kosch 2007). In the theory of justice Rawls consider the liberty and the different principle which it change of the classical model of the social contract by explain the social inequality within a distributive veil of ignorance. Rawls in the veal of ignorance tries to explain that the individual in the society have a system of equality. Accordingly, Rawls says that each person have an equal right to the most general proposal of equal basic liberties compatible with similar rights of liberties of others (Rawls, 1999 (ed) p.53). Moreover, these basic principles are absolute and cannot be violated, an example of these right freedom from arbitrary arrest and the freedom of speech (Rawls, 1999 (ed), p.53). However, Kant's theory of social contract is based by his emphasis of innate morality, Rawls acknowledge difference and social inequality as compatible within the "justice" paradigm. For example in the term of the inequality distribution Rawls says that inequality is only acceptable in the theory of justice under the second principle. This undermines the Kantian ideas of the cosmopolitan system of justice which based in an innate moral propensity towards democracy as a result of the human intellectual independence. In theory of the rationale for being human Kant's suggests that it is the interrelationship between intellectual independence and morality this considers be that is central to concepts of democracy. In this point, there will be social inequality, Rawls goes further to justify this in his theory of justice model on the grounds that the social differences are acceptable if they are the maximum benefits to the least advantaged members of the society (Rawls, 1999, (eds) p.84) . Rawls goes further and suggests that there can be unequal basic rights in proof of fixed natural characteristics. According to Rawls " if say, men are favoured in the assignment of basic rights, this inequality is justified by the difference principle.only if it is to the advantage of women and acceptable from their standpoint"(Rawls, 1999, (eds) (p.85). However, the difference principle makes it clear that Rawls denouncement of the cosmopolitan justice principle, his argument appears to be inherently flawed in effectively sanctioning discrimination on subjective grounds. Furthermore, there is

Visitor Attraction Management on London Eye UK Essay - 1

Visitor Attraction Management on London Eye UK - Essay Example This essay discusses the origin of the London eye and its birth, and the millions of people, both citizens and tourists that it attracts. Its features and major activities that are inclusive including the recent developments and innovations are discussed. The opportunity section covers a wide range of those opportunities that the management has grabbed and made a fortune out of them. Secondly, the foreseen opportunities like the 2012 London Olympics are also discussed, as well as survey on external environment and how to outwit the rival competitor. The challenges are inclusive of what the attraction has faced since its birth and the future hindrances that may occur as its operations continue. Moreover, the paper discusses the competitive advantage and the factors that would lead to the attraction attaining and sustaining its competitive advantage. Recommendations are given on the issues that need to be evaluated to maintain the stability of the attraction. Marketing strategies like cost leadership and product differentiation are explained. Effective management is also explained in a way that would help the attraction to improve its employee’s performance and at the same time meeting the customer’s needs. The tourist classification is reviewed hence providing management with options on how to continue attracting a good number of visitors. Mainly the role of management in this attraction business is explained through a committed management team and motivated staff, which contribute to success.

Genetically Modified Foods Essay Example for Free

Genetically Modified Foods Essay The world is slowly running out of food. Impoverished people have nowhere to turn. Biotechnology researchers think they have found a way to reverse the world famine. This way is through genetically modified foods which are foods that come from genetically engineered organisms. Examples of such organisms are sheep, cows, and fish. However, since it is a new invention, it is being met with harsh and legitimate concerns. While it may help the world’s food crisis, it may also do that at the expense of human health. Moreover, In the 90’s in the USA, the Food and Drug Administration decided that genetically modified food was safe and did not require special regulation. They stated that is was, â€Å"not inherently dangerous. † (FDA, 1998). This allowed genetically modified food such as soybean oils and tomatoes to enter the market. There are lots of ideas about the GMF. Some scientists say that it is no harmful affects of GMF and it may be a solution for scarcity of food and even it is healthy. However, some others say that GMFs are dangerous for public health. And It can damage biodiversity. Genetically modified foods may be a good solition to increase the amount of food. The problem is there are lots of people go to sleep hungry everyday and the number of hungry people is getting bigger. And International Food Policy Research Institute state there are â€Å"120 devoloping countries† which are very close to limit of hunger and â€Å"57 of which with a serious or worse hunger situation. (Global Hunger Index, 7) The reason of this hunger is there is not enough food to feed them and because the world population is getting higher but the areas which use in farming are getting smaller. Farmers could not find suitable area to plant their crops. That is why, They have to find a different solution to be productive. Conko argues that biotech agriculture is the method by which we can increase agricultural productivity without resorting to increases in harmful chemical fertilizers, herbicides, and pesticides. In the Genetic Modification it says that genetic modification provides a means to confer resistance to broad-spectrum herbicides into crops where current weed control is considered difficult. In this way, farmers can be more productive and they can get more product on their fields. â€Å"In the United States, in 2002 about 5. 5 million farmers in 145 nations were planting more than 145 million acres worth of GM crops. † (Conko) On the other hand, genetically modified herbicide tolerant crops might have a negative impact on biodiversity. Genetically Modified crops have an impact on birds and insect. A crop plant modified to be toxic to insect pests can have a direct harmful effect on non-target insects if they eat the plant. It can also have an indirect effect by reducing the insects that are a food source for other wildlife, such as farmland birds. Genetically Modified crops that are tolerant to herbicides could also lead to a reduction in weed populations that act as refuges for beneficial insects, and those that are eaten by birds. This process takes time because of this GM crops evaluate as a good solution but it can destroy the biological diversity. And US conservation organization Royal Society,founded in London In 1660 is a learned society for science, support it. They state that the likelihood of the spread of Genetically modified into the wild populations, the risk of superweeds being produced, the impact Genetically modified introductions might have on the colonies of micro organisms living in the soil and how such risks can be assesed and analysed. Also John Innes Centre, Founded in England is an independent centre for research and training in plant and microbial science, state that Monarch butterfly larvae fed only on leaves covered in pollen from Bt corn grew more slowly and suffered higher death rates and pink bollworm fed on cotton producing the Bt toxin. Aphids fed on Genetically Modified potatoes producing a different toxin were also reported to have a harmful effect on ladybirds feeding on the aphids. Genetically Modified crops can be beneficial for health in terms of their food value. Foods include lots of vitamins which are necessary to our body. In early days, our foods were full of vitamins, proteins, carbohydrate and they were occupied with value. However, now there are not enough foods which are full of value. Because there are lots of environmental factors like global warming which causes to summers takes long time, and scarcity of water, and also some pests. These factors effect the crops and farmers have to use pesticide and this cause to decrease food value. And it leads lots of health problems. And the one of the most important health problem is Vitamin A deficiency. This is the cause of at least â€Å"1 million childhood deaths† each year and is â€Å"considered the single most serious cause of blindness amongst children† in the developing countries. â€Å"A possible solution to this problem is the genetic modification of rice. † ( Potrykus, quoted inGenetic Modification) Although GM foods are benefical for the food value, in some circumstances, it can be very harmful for human health. Without too much control eating genetically modified food can be dangerous and it can lead lots of diseases like Eosonophil Myalgia Syndrome. In this debate, the Physicians and Scientists for Responsible Application of Science and Technology, is a website to educate the general public about genetic engineering in general and foods, revealed that After eating a food supplement produced by genetically engineered bacteria, â€Å"37 persons were killed 1500 people were permanently disabled† in the US in a disease called Eosonophil Myalgia Syndrome. It was caused by one or more extremely poisonous substances that unexpectdedly appeared in this food supplement. This accident confirms the predictions of molecular biologists that genetic engineering can cause the appearance of dangerous unexpected substances. As a Conclusion, there are lots of arguments in the GMF. Maybe It can be a solution for lots of problems, maybe it can be invention of the this century. I think, however, without too much researching about GMF we cannot use it to gain profit. Because human health is important than anything. We have to more careful. In the future, After very deep research about the GMF, we can solve the sustanibility problem.

Effect of Laws on Crime Prevention

Effect of Laws on Crime Prevention Can laws help to stop crimes? Introduction Crime is when an individual violates the law of a country he/she is living in. However, this does not necessarily mean that crime is always wrong. The law also prevents people from doing things that harm other people, such as murdering, and stealing, and smuggling, and raping, and the list goes on and on. Police in many countries can’t take action against people until they find a witness for the crime so at this moment people doing crime come in and take advantage of it. But some laws are wrong too. It seems like the person who controls the law will be like God on earth. Through law, he is given the power to punish. And if the person controlling law were to be lets say, corrupted and self-interested? Laws passed would be unjust and only serve the purpose of that person. This would be very unfair. But because it is law, you have to follow it, or suffer. So as said by Mohandas Karamchand Gandhi An unjust law is itself a species of violence. Arrest for its breach is more so. Global Crimes against humanity are particularly revolting offenses in that they constitute a serious attack on human dignity or grave humiliation or a degradation of human beings. They not isolated or sporadic events but could be caused by government laws and rules, or wide practice of atrocities which is illegal in the books of law by the government. Extermination, torture, rape, religious persecution, Murder, racial, political and other inhumane acts reach the doorstep of crimes against humanity only if they are part of an organized or extensive practice. Crimes can be the done at many different ways For example: A crime against peace, in international law, refers to planning, preparation, initiation, or waging of wars of aggression, or a war in violation of international treaties, agreements or assurances, or participation in a common plan or conspiracy for the accomplishment of any of the foregoing. International crime law is a branch dealing with all the inter country crime. The term is commonly used in the law enforcement and academic communities. The word transnational describes crimes that are not only international but crimes that by their nature involve international crimes. Transnational crimes are crime done in one country but their effects affect other countries and transit countries may also be involved. Examples of transnational crimes include: Human trafficking, people smuggling, smuggling/trafficking of goods (such as arms trafficking and drug trafficking and illegal animal and plant products and other goods prohibited on environmental grounds (e.g. banned ozone depleting substances), sex slavery, terrorism offences and torture.Classical international law governs the relationships, rights, and responsibilities of states. International criminal law comprises elements of both in that its consequences are penal sanctions imposed on individuals although its sources are those of international law. The Rome Statute of the International Criminal Court helps to deal with these international crimes. The Rome Statute of the International Criminal Court (often referred to as the International Criminal Court Statute or the Rome Statute) is the accord that established the International Criminal Court (ICC). The Rome Statute established four core international crimes: genocide, crimes against humanity, war crimes and the crime of aggression. National Crime in India exists in various forms taking note of prostitution , poaching, gunrunning, extortion, human trafficking, drug trafficking, murder for hire, money laundering and fraud. Many criminal operations engage in black marketeering, political violence, religiously motivated violence, terrorism, and abduction. Other crimes are homicide, robbery, assault etc. Property crimes include burglary, theft, motor vehicle theft, and arson. Corruption is a significant problem. One of the examples are:- In late December, 2012, international attention was called to a case of a 23-year-old Indian woman (Also called as NIRBHAYA case/ AMANAT case) was assaulted and gang raped on a bus (incident took place on 16 December, 2012), resulting in death eventually after a few days of critical situation. Mass protests stemming from the case called into question the cultural violence towards women and the failure of the government to help people and solve their problems. The problem was compounded by po liticians making sexist and misogynistic comments. Looking at the increase in rapes the government had passed a law stated that a women can harm a man’s private parts if the man tries to rape a girl. A report stated that after an increase in rapes slowly after the law was passed the rapes decreased by a significant amount. In 1961, the Indian government passed the Dowry Prohibition Act which means that asking dowry from the girl’s side by the boy’s side was made illegal and also stated strict steps would be taken if not followed the law. However, many cases of dowry-related domestic violence, suicides and murders have been reported. In the 1980s, numerous such cases were reported. However, recent reports show that the number of these crimes has reduced drastically. Child marriage has been traditionally prevalent in India and continues to this day which means a child is married before it reaches an age of 20. Young girls live with their parents until they reach p uberty. In the past, the child widows were condemned to a life of great agony, shaving heads, living in isolation, and shunned by the society. Although child marriage was outlawed in 1860, it is still a common practice. It is prevalent within every section and every level of the society. Corruption has taken the role of a pervasive aspect of Indian politics. In India, corruption takes the form of bribes, evasion of tax and exchange controls, embezzlement, etc. G.P. Joshi, the programmed coordinator of the Indian branch of the Commonwealth Human Rights Initiative in New Delhi comments that the main issue at hand concerning police violence is a lack of accountability of the police. In 2006, the Supreme Court of India in a judgment in the .In 2006, seven policemen were charge sheeted and eleven were convicted for custodial misconduct. Jan Local Bill is being planned to reduce the corruption. Currently many government parties are working to reduce corruption and it is showing results. B ribing is the most famous form of corruption. For example if a driver is caught violating the rules the police has to make an entry in the books and fine the driver. But in India the driver bribes the police cop and the cop doesn’t make any entry of the crime, rather takes the money for his own use. Local There might be a too many crimes in the metropolis, but when compared to 52 other cities across the country, Mumbai, with its huge population, seems to fare much better than other places in maintaining law and order, reveals a data by National Crime Records Bureau.For the first time, the NCRB has analyzed crime data in 53 major cities in the country. Given its huge population, the rate of crime is, no doubt, high in Mumbai, but when we compared the situation with 52 other cities, we feel it is much better here, a senior home department official stated. As Mumbai has grown exponentially in the last several years, so has the rate of crime. Mumbai’s crime level is medium to high for a city with more than 20 million people. Based on available Mumbai Police statistics, the crime rate continues to be an ongoing problem for the tremendously short-staffed city police. Mumbai law enforcement has 33,000 officers (165 officers for every 100,000 citizens) to police its rapidly growing cit y, which is 20 % less than what they are authorized. An international standard, the recommended police strength per 100,000 persons, is 222 officers. Crime has affected expatriates with reports of burglary, stolen bags and passports, and valuables being fairly common; however, most of these crimes occur in a non-confrontational manner, usually through stealth or forgetfulness of the victim.While street crime such as pick-pocketing and robbery/assault is not uncommon, areas frequented by foreigners are less vulnerable due to a generally adequate police presence.Violent crimes do occur in Mumbai, but for the most part, are isolated in more high density areas such as slums and crowded apartment blocks. The police in Mumbai are showing great performance and intelligence to control crime as stated in a local newspaper. There are many incidents seen where a group of people loot a girl and kill them and the evidence for it is the TV show â€Å"Crime Patrol†, it I based on real incid ents in India. Laws can just help to reduce crimes but not stop it completely Bibliography http://en.wikipedia.org/wiki/Crime_against_peace http://en.wikipedia.org/wiki/Crime_against_humanity http://en.wikipedia.org/wiki/International_crime http://en.wikipedia.org/wiki/Crime_against_international_law http://en.wikipedia.org/wiki/Rome_Statute_of_the_International_Criminal_Court http://en.wikipedia.org/wiki/Crime_in_India http://en.wikipedia.org/wiki/Transnational_crime http://www.csj.gob.sv/Comunicaciones/quehacer/English/Images/Quehacer_60/teoria_3.jpg http://govcentral.monster.com/nfs/govcentral/attachment_images/0004/0369/crimjust_crop380w.jpg?1224716277 http://blog.myphillylawyer.com/wp-content/uploads/2010/05/May-28-driving-tests-iStock_000009697473XSmall.jpg

Immune System of a Plant

Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà ­a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164  µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10  µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65 °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20  µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65 °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37 °C and resuspended in sterile deionized water for a final volume of 500  µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20  µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200  µM dNTPs, 0.2  µM forward primer, 0.2  µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1  µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ã…Â az ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin

Analysis Of O. Henrys art And The Bronco :: essays research papers

Art and the Bronco summary O. Henry’s "Art and the Bronco" tells the story of Lonny Briscoe, a cowboy who is also an aspiring artist. It follows his quest to sell his first painting to the state legislature; to have it hung in the capital building. Lonny sees the sale of the painting as validation of his talent and worth as a painter. What he ends up learning is that the actual value of the painting turns out to be secondary to what other feel they can gain from it. The story takes place in San Saba, a place trying to shed its image of "†¦barbarism, lawbreaking, and bloodshed." It presents itself as a much more refined place now, one which is now safe for tourism and business. The Legislature was lending subsidy to the arts to enhance this image. Lonny’s painting is hanging in the capital building. It is a large painting "†¦one might even say panorama," depicting a cowboy and steer, hung in a gilt frame. At the capital, we are introduced to senators Kinney and Mullens, who only care about getting what they want from each other and getting re-elected. They see Lonny’s painting as a means to both ends. In the beginning, Kinney sees nothing of value in Lonny’s picture. In fact, he implies that it is awful, saying that he "†¦wouldn’t give six bits for the picture without the frame." Mullens agrees with Kinney’s assessment of the painting. He says that the painting is secondary to the artist—the grandson of Lucien Briscoe, a legendary local hero who is said to have "†¦carved the state out of the wilderness." The painting quickly fades to the background as both the senators see that pushing the state to give this hero’s grandson money is a quick way to gain public favor. Lonny’s cowboy friends ride into town to push the paintings merits as well, adding their admiration for the gilt frame, so big and beautiful. They are very simple and undereducated, as evidenced by Skinny Rogers’ act of leaping away from the painting yelling "†¦Jeeming Cristopher! Thought that rattler was a gin-u-ine one," and are not as concerned about the merits of the painting as they are with the idea of one of their own getting money for it. They always speak loudly when they think there might be someone around to whom their comments might be "†¦profitably addressed."

Consider how Blake Edwards Present Issues of identity and possession :: English Literature

Consider how Blake Edwards Present Issues of identity and possession in Breakfast at Tiffany's In this essay, I am going to analyse the different techniques Blake Edwards used to present issues of identity and possession in the film "Breakfast at Tiffany's" Breakfast at Tiffany's is a film that was directed by Blake Edwards in 1961. It deals with romance and life in the 1960's. The film was originally Based on the book "Breakfast at Tiffany's" by Truman Capote, who wrote the book during the 1958's, which suggests that he must have experienced the style of life in the 1960's. Holly Golightly, the most important female character, in the film was played by Audrey Hepburn, who is one of the most famous Hollywood actresses at that time. The film consists of many genres eg: romance, comedy, so the film would suit a wider ranger of audiences. I do believe that the film was aimed at adults, because Blake Edwards has given the characters in the film a complicated contrast of personality and identity. Issues of identity and possession changes and is revealed bit by bit throughout the film. The director has made Holly Golightly the centre of identity and possession, and made every other character move around Holly, revealing her identity, personality and past. There are many different camera angles like close up of Holly when she is singing or when the characters are talking. The camera angles like close ups can often show what a character is thinking or what their personality is like, for eg: when Holly was singing moon river, the close up shows that Holly is a gentile and kind person. Holly's cat hasn't got a name, in fact we don't know anything about the cat, where it came from or its gender. In the film Holly says, that she would only name the cat when she feels that she is rich enough. The cat is a symbol of mystery, that represents Holly. There are many types of dialogue. Sometimes during the film body language and silent dialogue, is used to express a characters feelings, for example: In the scene of the party, we see a woman standing in front of a mirror, crying then laughing, without saying anything. Facial expressions are also used to show a characters feelings instead of saying their feelings. This could be more effective than dialogue, eg: when Holly says she is not going back with Doc, the expressions on Doc's face show us that he is deeply hurt. Holly seems very strange sometimes, she compares he past boy friends with objects that mean much to her. Holly says that you can tell how

Begin With The End In Mind

The thesis topic, â€Å"Begin With The End In Mind† is from the book â€Å"The 7 Habits of Highly Effective People† written by Stephen R. Covey. Prior to writing this book Covey had over 25 years of experience dealing with business issues such as helping companies and their employees to be more effective and efficient in their work. Stephen R. Covey leads seminars teaching managers to â€Å"do the right thing† as opposed to â€Å"doing things right.† In a nutshell, that's the difference between being effective and being merely efficient. Stephen R. Covey is chairman and founder of Covey Leadership Center, a worldwide, 700 member leadership development firms. He is author of the phenomenally successful best seller The Seven Habits of Highly Successful People, with over 6 million copies sold in 32 languages. Dr. Covey is respected internationally as an author, lecturer, teacher and leadership mentor. For more than 30 years, he has trained thousands of leaders in business, industry, education and government. Stephen has a doctorate degree from Brigham Young University, an M.B.A. degree from Harvard University, and a Bachelor of Science degree cum Laude, from the University of Utah. He has served as an officer and board member of several corporations, an administrative assistant to the president of Brigham Young University, a visiting professor at the University of Utah and at Belfast Technical College, as well as a popular faculty member for the Young President's Organization. Dr. Covey is also the creator of â€Å"The Masters,† a nationally acclaimed management development program; publisher of Executive Excellence, an executive advisory newsletter; and producer of the Seven Habits video and audio training programs and organizer. He is married to Sandra Merrill Covey, and they are the parents of nine children. Overview of the Book: Stephen R. Covey's The Seven Habits of Highly Effective People was first published in 1989. Since that time, the seven habits he identified and described have been used by scores of individuals and organizations to improve their effectiveness. Stephen R. Covey's incredibly successful book is a pathway to wisdom and power. It offers a revolutionary program to breaking the patterns of self-defeating behavior that keep us from achieving our goals and reaching our fullest potential, and describes how to replace them with a principle-focused approach to problem solving. Covey in his book The 7 Habits Of Highly Effective People explains in-depth the 7 habits that makes people effective in their work. In the book Covey explains the concepts by giving real world examples. He also guides the readers, how they can follow the 7 habits of highly effective people. Following are the 7 habits discussed by Covey in his book. 1) Be Proactive 2) Begin with the End in Mind 3) Put First Things First 4) Think Win/Win 5) Seek First to Understand, Then to be Understood 6) Synergize 7) Sharpen the Saw Begin With The End In Mind: Great advice is often ignored because it sounds so matter-of-fact, makes such common sense, and is so simple that it just cannot be that good. Anyone could have thought of that idea, and probably has – so what's new? â€Å"Begin with the end in mind† is one such thought and is presented by Stephen Covey in his series of books on the 7 Habits of Highly Successful People. You have to think ahead to your goal or your destination before you can plan the steps or plot the route needed to reach it. And that makes good sense! STOP – right now – whatever you are doing. Now, ask yourself, what is the end (the purpose) of reading this thesis? If you do not know, then why are you reading it? Everything that you do, you do for a reason. However, you may not always be aware of that reason. Habit 2 â€Å"Begin with the end in mind† is all about knowing why you do what you are doing. Your starting point is a set of goals, targets, missions, visions or dreams. These give purpose to all that you do. If you do not follow this Habit; > You will spend your leisure time the way TV companies want you to > You will buy what advertisers want you to > You will take the first half-decent job that comes along > At the end of the day, you will have no idea what you have achieved If you do follow this Habit; > Your leisure time will be amazing > You will spend less and enjoy it more > Your job will match your desires and your talents > At the end of the day, you will look back over many worthwhile achievements To get into this habit; > At the end of every day, decide what you will achieve the next day > During the day, regularly ask yourself why you are doing what you are doing. If you do not get a good answer, do something else Imagine that our minds are like a camera lens. When we zoom in on the details, the big picture gets out of focus. And when we take a wide-angle view, we can see more opportunities and then choose which actions we'll take to seize those opportunities. A wide-angle view can provide the motivation needed to focus on all the details needed to make something happen. In Stephen Covey's book, The Seven Habits of Highly Effective People, Habit #2 is to â€Å"Begin with the end in mind.† By focusing on the final outcome first, you can get clearer about what it would look and feel like if you were already there. This wider focus makes it easier to see more opportunities and possibilities than we can see when we only focus on the details. Author Stephen R. Covey in his theory presents a holistic, integrated, principle-centered approach for solving personal and professional problems. With penetrating insights and pointed anecdotes, Covey reveals a step-by-step pathway for living with fairness, integrity, honesty, and human dignity — principles that give us the security to adapt to change and the wisdom and power to take advantage of the opportunities that change creates. According to Covey, â€Å"begin with the end in the mind† means, you know where you are heading and you know what your destination is. In other word you should not start your trip without knowing your destination/Goal. For e.g. if you want to go to your friend's house, you need to know the exact address of the house otherwise you may waste your time and possibly you will not be able to reach his house. Just by sitting in the car and start driving you will not help you reach your friend's house. The most effective and efficient way of reaching your friend's house is to make sure that you have the address (The end) before you start your trip What is Goal? The definition of Goal is the end that one strives to attain. It's the object of a person's ambition, desire or final destination. Are goals really an end to something? They are just the beginning. Once you set and reach your goals you are on your way to achieving greater heights, unlimited heights. Here are some tips on goals. > The most successful people have goals. Their goals are specific, measurable and positive. Goals are not dreams, they are achievable within reach. > Goals must be achievable and believable. If you don't believe you can reach your goal then you won't. Make sure you are really committed to your goal. > Don't waste your time, energy and emotions on goals that you don't believe you can achieve. > Share your goal, write your goal down, look at your goal everyday. The best goals are the ones that cause you to stretch yourself in order to reach them. In other words if you want to set a financial goal for sales or business, set one that you think you can reach then add 20%. This will cause you to stretch and go beyond your comfort zone. How are you going to achieve your goal? Here's how you do it. > Think of a goal that is specific, measurable, explicit and positive. One that is reachable with a stretch. > Then you ask yourself, when do you plan to achieve it? 6 months? 1 year? 5 years? > Now work backwards from that point. What do you have to do? What are your monthly, weekly and daily milestones and actions? In other words what are your short-term goals to achieve your long-term goal? > Always keep the end/goal and the reason you want to achieve the goal in your mind. In this way you will stay determined and focused to achieve your goal. Make goals or choices that are: > Specific – Have a crystal clear picture of the desired outcome. > Measurable – How will you know you have achieved your desired outcome? How will you measure it? > Achievable – Create a step-by-step plan to accomplish what you want. > Relevant – Does this goal fit within the bigger picture (wide-angle view) of what is most important to you? > Time-bound – What is the timeline for accomplishing what you want? Begin with the End in Mind means to begin each day or task with a clear understanding of your desired direction and destination. By keeping that end in mind you can make certain that whatever you do on any particular day does not violate the criteria you have defined as supremely important, and that each day of your life contributes in a meaningful way to the vision you have of your life as a whole. Importance of setting Goal/End The key to success is setting up goals. If you have a goal then you will strive to achieve it, you will be motivated, and focused. If you have a goal in front of you, you will know what you want to achieve, and why you want to achieve those things. Therefore, if you know your goal, stay focused, and you know the reasons for achieving the goal then you will successfully achieve your goal. In work force there are 2 types of people: First types of people are the ones who are working because they have to feed themselves and their family. These are the people who do not look forward, who do not look at the end, and who do not have goals. As far as their basic needs are filled they are happy. They do not have any goals and therefore do not strive to achieve them. In most cases these types of people will remain at the same position from where they started. Second types of people are those who have ambitions, goals and they have the end in their mind. They are not satisfied with just feeding themselves and their family. They get satisfaction when they take a step forward to achieve their goal. They work hard and are intrinsically motivated. They are the employees who are successful and make the business successful because they have end/goal in their mind. They are most likely to get promotions in company very quickly. They will keep moving and will give their 100% to reach their destination/goal. For Covey a personal mission statement is the key to effective decision-making. Through a series of thoughtful exercises, Covey leads the reader to identify what is truly important in his or her life. A personal mission statement answers two essential questions: > What am I about? > Upon what principles do I operate my life? A person without such a mission, Covey writes â€Å"fluctuates from one center to another, the resulting relativism is like roller coasting through life. One moment you're high, the next moment you're low†¦There is no consistent sense of direction, no persistent wisdom, no steady power supply or sense of personal, intrinsic worth and identity. â€Å"The ideal, of course, is to create one clear center from which you consistently derive a high degree of security, guidance, wisdom and power, empowering your proactively and giving congruency and harmony to every part of your life.† Similarly, we believe it is important for every aspect of life, in a reflective and thoughtful way, to develop a mission statement. Imagine the rich conversation and the benefit to all of the people of the world if get to answer: 1) What is my life all about? and 2) Upon what principles do I operate? Mission statements, along with a set of goals, allow stating exactly what it desires for everyone -i.e., to define the ends toward which everyone is collectively striving. Searching for synergy and focus, one may want to encourage family, teachers, parents, community members, and themselves to help develop a certain mission statement. In this way everyone can â€Å"begin with the end in mind.† Typically, many people are successful managers-of their own lives, of their farms, of their homes, of their work or business interests-and it is often difficult to move from the tried and true management approach to the leadership function. Jesse Jackson is quoted as saying: â€Å"We do best what we do most.† It is difficult to step up to leadership issues when our comfort zone is in the management arena. Shifting the focus from the means (what we do most) to ends is tough work. We find it easier to debate the merits of a particular problem-solving approach-knowing in our heart of hearts that we are not accountable for actually solving the problem-than it is to determine the vision for the bigger picture The most effective way I know to begin with the end in mind is to develop a personal mission statement or philosophy or creed. It focuses on what you want to be (character) and to do (contributions and achievements) and on the values and principles upon which being and doing are based. In order to write a personal mission statement, we must begin at the very center of our circle of influence, that center comprised of our most basic paradigms, the lens through which we see the world. Whatever is at the center of our life will be the source of our security, guidance, wisdom, wisdom, and power. Who are busy people? According to Covey people who do not have goals/end are the people who are busy and are liability for their employers. People watching them might think they are working hard but in reality they are wasting their time and the money of the company they are working for. They have the tendency of rushing things; they will start things without knowing the cause and the effects. They will never plan and never look at the end. They are one of those people who will sit in the car without know where exactly they are going. These characteristics make them inefficient employees. Covey's words, the Logic Model and other tools encourage us to first think about what we want our final results to be, then to plan and carry out the steps required to reach those results, whether in our teaching, our personal lives or other situations. In teaching, think, â€Å"What do I want your students to be able to do when they leave the class?† rather than â€Å"How many experiments can you fit into the semester?† Consider â€Å"How should these producers change their practices after your session?† rather than â€Å"How many Power points can you fit into my 45 minutes?† Ponder, â€Å"What actions do you want these youth to take after the camp?† instead of â€Å"How can I keep these kids busy all day?† Covey says, â€Å"Begin with the end in mind is based on the principle that all things are created twice. There's a mental or first creation, and a physical or second creation to all things.† For example, when building a new home, we visualize how we want the exterior and each room to look. Then we develop the blueprint and gather the materials, then actually carry out the construction. In education, we visualize what we want our learners to do (the desired outcomes), then organize what we need make this happen (the inputs), then carry out the program (the outputs). Don't confuse urgency with importance: As you go through your week, there will undoubtedly be times when your integrity will be placed on the line. The popularity of reacting to the urgent but unimportant priorities of other people or the pleasure of escaping to unimportant activities will threaten to overpower the important activities you have planned. Your principle center; your self-awareness, and your conscience can provide a high degree of intrinsic security, guidance, and wisdom to empower you to use your independent will and maintain integrity to the truly important. Time management has evolved beyond the basic idea of organizing and executing around priorities, the author says. Many managers are good at scheduling their time and setting goals. So why is frustration so often the end result? Why do managers regress into primitive techniques, writing themselves notes, making checklists, keeping calendars and appointment books? It's because the object of management should be you, not time. Don't confuse urgency with importance. Crisis managers who live from one problem and deadline to the next always have one waiting. The only relief is in busy work-opening mail, making a few nonessential phone calls, wasting time in pleasantries. That overlooks the big middle and Covey sees his mission as sorting out what is really important for executives who don't have time to do so themselves. Covey has made a life study of personal paradigms and has found, among other things that â€Å"we never really understand what's going on inside another human being.† We're overdrawn on our â€Å"Emotional Bank Account.† When we try to persuade people of something, we overlook the ancient Greek art of rhetoric, which involves presenting our character and communicating our feelings before presenting the logical argument. Instead, we go straight to logic. A business organization jam-packed with effective people would really be a sight to see. The obstacles to being your own agent of change are so formidable that most people can only wish it will happen. If inspiration is the first step, this theory provides it. The evidence is now clear. A Vision for the END: Almost all of the world-class athletes and other peak performers are visualizers. They see it; they feel it; they experience it before they actually do it. They Begin with an End in Mind. You can do it in every area of your life. Before a performance, a sales presentation, a difficult confrontation, or the daily challenge of meeting a goal – see it clearly, vividly, relentlessly, over and over again. Create an internal â€Å"comfort zone.† Then, when you get into the situation, it isn't foreign, it doesn't scare you. Begin with the end in mind. (This is the Principle of Personal Leadership) Look at where you want to go. What does â€Å"being successful† mean to you? What is really important? â€Å"All things are created twice.† Leadership is the first creation. Management is the second creation. The leader has a vision. The manager implements the vision. Management is the efficiency in climbing the ladder of success: leadership determines whether the ladder is leaning against the right wall. If you do not plan, things are going to evolve on their own and out of control. You need to re-script: impose your vision on situations, become the first creator. You may want to develop a Big Picture vision: it is your Personal Mission Statement. In this statement, you will have to include the following values: Security, Guidance, Wisdom, and Power. You need to recognize your centers. Some of us are spouse centered, family centered, money centered, work centered, possession centered, friend/enemy centered or religion centered. Try to find your de facto center. The ideal would be to be Principle Centered. To develop a Personal Mission Statement, you need to use your whole brain: your mind and your emotions; your logic and your intuitions. Then you can try writing a Mission Statement for your family, your organization. Security Represents your sense of worth, your identity, your emotional anchorage, your self-esteem, your basic personal strength or lack of it. Guidance means your source of direction in life. Encompassed by your map, your internal frame of reference that interprets for you what is happening out there. Wisdom in your perspective on life, your sense of balance, your understanding of how the various parts and principles relate to each other. Power is the faculty or capacity to act, the strength and potency to accomplish something. Covey lists several advantages to principle-centered personal decision-making, which can lead to achieving the desired results. > Proactively choose what it determines to be the best alternative, rather than reacting to other people or circumstances. > Make choices that are in keeping with its ultimate values. > Feel comfortable about your decisions because they are based on unchanging principles. You have to decide what your highest priorities are and have the courage–pleasantly, smilingly, nonapologetically — to say ‘no' to other things. And the way you do that is by having a bigger ‘yes' burning inside. The enemy of the ‘best' is often the ‘good.' Prior to any measurement one must have a target/reference, where one can find if that process has been improved or detoriated upon certain action taken. Key criteria must be established prior to any action. Although, it would be naive to celebrate any short-term improvement (apparent) without any action taken. What is the balance between leading and managing? It is important for us to clarify the difference between ends and means. The focus on the ends must be both individual and collective. People who choose to work at this level can begin at any point, and move out from there â€Å"We are more in need of a vision or destination, and less in need of a map. Leaders create their own destiny by following their internal compass. They make their life a mission, not just a career.† This habit refers to the fact that our behavior must not be driven at random, we must have precise objectives to achieve: Buy a house or a car; earn a degree in the university; achieve a promotion in our job. Every time we make an important decision we must ask ourselves if this decision is approaching our goal. Begin with the End in Mind means to begin each day or task with a clear understanding of your destination, thus making certain that whatever you do that day contributes to your ultimate goal in life. As we choose, so we become: Do you accept full responsibility for the choices you make? Have the choices you've made in the past taken you to where you want to go? Pretend it's your eightieth birthday and all your friends and family have come to celebrate. Each will get up in front of the group and reflect on your many accomplishments. What will they say? What do you want them to say? â€Å"Destiny is not a matter of chance, it is a matter of choice; it is not a thing to be waited for, it is a thing to be achieved.† – Unknown Different choices take us down different roads. To make sure that the road you choose will lead to your ultimate destination, it can help to imagine it's your eightieth birthday when all of your friends and relatives have gathered on the occasion to stand before you and describe all of the magnificent accomplishments of your life. When I hear others complaining about negative things happening in their lives, I am reminded that everything we have, everything we are, is a byproduct of the choices we make. Nothing happens to us that we do not choose, whether consciously or unconsciously. Want to have a better life? Make better choices. Our health is a good example. When we complain that we feel tired, run down, overweight or stressed out, perhaps we need to realize it's because of the poor choices we've made. A sedentary lifestyle or one filled with too much fat, sugar, caffeine or alcohol, will not result in a healthy body. Dr. Bernie Siegel asks his patients, â€Å"Why did you choose this disease?† Optimum wellness is a choice! And what about your career? Your mama didn't tell you to become a widget repairman! If you dislike your job and really want to make a contribution to society or express your true talents, heed the words of Nike and â€Å"Just do it!† The only thing standing in the way of the job or career you desire is you. Don't just sit around waiting for things to change to your liking because chances are they never will. You must be the change agent. You must manifest what is you desire! â€Å"Better Lives Begin with Better Choices† To make better choices and live the life of our dreams, we must focus on a couple of key questions. First, will this choice bring me closer to learning who I am and becoming who I want to be? We often make decisions and choices too quickly without taking into consideration the long-term consequences. Every decision today creates the world we will inherit tomorrow. Or looked at another way-your life today is the sum total of all the choices you made in the past. After you have identified the accomplishments that will in essence become your legacy, do what Stephen Covey says and â€Å"begin with the end in mind.† In other words, work backwards from where you want to end up in your lifetime and make choices today that will lead you there. Don't settle for anything less! Next, I think it is important to determine on a scale of 1 to 10, whether the choice you are about to make is your highest choice. How will you know? Your highest choice will always be the one that is void of any ego attachment and will reflect the inner direction of your soul. Normally, your highest choice will not be the first choice that comes to mind because the ego will usually override your soul and scream the loudest! The ego is very clever and knows exactly how to distort what it is we really want. Whenever I find I have made a poor choice, I usually realize that my ego found a way to shut out my heart. It's as simple as that. To quiet the ego and let your soul speak, you must be out of your mind. In other words, you must turn your mind off and let your soul, heart and feelings take over. Find some quiet time-get off by yourself-and without distraction, learn to be still. Then, move from the stillness to a meditative state. This will provide an environment in which the voice of the soul can be heard. The soul, you see, is a rather polite fellow. It will always remain quiet in the presence of more boisterous competition such as the ego. Your challenge is to find a way to get the ego to shut up just long enough for the soul to speak. During meditation, try on your various choices in the context of how you feel once you have made them. In other words, see yourself as having already made the decision. How does it feel? Do you feel lighter, happier, and full of energy? Or is there a queasy feeling in your gut? Repeat this exercise as many times as necessary until the decision lines up with your highest values and beliefs. Oh, and that little voice you're hearing in your head; listen to it! It's there to help you along the path. While we're on the subject of meditation, please understand that setting in the lotus position with your legs wrapped around your neck is not a requirement. Frankly, not many people can sit like that for any length of time. It may be a good way to learn to scratch your nose with your big toe but how often will that come in handy? Find a position that feels comfortable and relaxed so that you can focus your attention on shutting down the inner-chatter of your mind and finding the voice of your soul. As we choose, so we become. Don't look back at your life from your eightieth birthday and wish things had turned out differently. Learn to make better choices today that allow you to leave the legacy you desire. Turn off the noise, turn up the silence and choose to become your highest gift. A better life awaits you! From the Decision Maker's Point of View: Stephen Covey's Habit 2 is â€Å"Begin with the end in mind†. From the Decision Theory point of view, it is essential to have a way to rank the options. If it doesn't matter what happens, then there's no reason to think about the choice. Flip a coin. Throw some sticks on the ground and look at the pattern. Tea leaves. Bird guts. But if you want to choose, you need to know what you want to accomplish. That means understanding the likely results of each option and then choosing between options to achieve those results. To rank outcomes we need values. What is good? More money. Longer life. Good for whom? Just me? Just my family? From Pringles to Austria. So part of Deciding Better is knowing what you value. Then you can make decisions that maximize that value. And when you make inappropriate decisions- the car that impresses the neighbors, when you don't hold â€Å"others opinions of me† as a value, you might make a different decision. Or rethink your values, understanding that what you think you value and how you act don't match. So begin with the end in mind. You aren't choosing options, you are choosing between likely results. But we know that the future is uncertain. That's where simulation and imagination help you decide From the Management/Business Point of View: Be it in business, real life, religion or any other walk of life the second of the seven habits described by Stephen Covey in The Seven Habits of Highly Effective People Begin with the end in mind answers all the questions. Pause for a minute and remember when you first thought about running for the board of education. What were you hoping would happen? What did you want to accomplish? What kind of organization were you hoping to give your time to? Simply put: What end did you have in mind? Advance the tape a little. How well did you convey your hopes-your vision-your ends-to the other board members? Did your hopes converge with theirs? Did the other board members share your vision? Did the board find ways to â€Å"speak with one voice† as it clarified its goals and objectives? Now fast forward. You have been on the board for a few years. Newer members have joined you. How have their hopes been blended into the new board's vision? If you answered the questions above, you have taken the first step toward defining the â€Å"end† or outcome you want for your school board. The images that describe those outcomes are the basis of a personal mission statement that will keep you on tract as you make decisions. Covey quotes the president of an oil company who attended a Seven Habits seminar. The man understood the difference between leadership and management, and decided to withdraw from managing his company to assume a position of leadership. â€Å"It was hard,† said the CEO, â€Å"I went through withdrawal pains because I stopped dealing with a lot of the pressing, urgent matters that were right in front of me and which gave me a sense of immediate accomplishment. I didn't receive much satisfaction as I started wrestling with the direction issues, the culture building issues, the deep analysis of problems, the seizing of new opportunities†¦But I persisted. I was absolutely convinced that I needed to provide leadership. And I did. Today our whole business is different†¦We have doubled our revenues and quadrupled our profits†¦Ã¢â‚¬  You need to consider yourself, your family and your community. Sit down and figure out how much you need to support your lifestyle, save for a secure retirement, put away for a college education, vacation, hobby, or fulfilling a dream, tithe your church, pay fines at Rotary or contribute to the community chest. Now, ask yourself, what return do you want from your investment in your business? If you took those same assets and made reasonable investments in CDs, bonds or stocks, how much would you make? This, as a minimum, should be your profit goal for your business. Next, realizing that your expenses dictate the â€Å"end† where you need to begin, add up your overhead costs from your P&L and balance sheet. Add to this figure any increases you anticipate in overhead, such as increases in rent, utilities, insurance or capital expenditures like a new vehicle. Divide the total of all your expenses, personal and business, by your historical gross profit margin, and voilà ¯Ã‚ ¿Ã‚ ½, you have your sales goal for the year! Well, maybe. Suppose that this sales goal is more than you want or can do because of such limiting factors as a shortage of qualified labor, a slowing economy or a commitment to your own sanity. Now, you have a choice: Modify the end you have in mind or think about how you can increase your gross profit By beginning with the end in mind, you are more likely to have a business that works for you. You can monitor your progress throughout the year to make sure you end up where you want to end up. By beginning with the end in mind, you can eliminate the nagging doubts about how much work to take or not. Instead, you know you are on a path that will meet your needs. You can have a whole new way of looking at your business and look forward to a successful year that is taking you where you want to go. Life is uncertain. Revolutionary entrepreneurs leap through conventions into the unknown. The future is waiting to be discovered. That discovery reveals itself in each moment. Our challenge is simple: to focus on what needs to be done now and trust that our next steps are enough. Taking a Religious Glance: Each of us should â€Å"Begin with the End in Mind.† We will one day stand before God. How does that affect where you are right now? How does that affect the direction that you are walking? It should give clarity of purpose to your walk for the end. It should motivate, encourage and direct. The reason that people wander aimlessly in life, many times away from God, is that they have never thought to â€Å"Begin with the End in Mind.† You can only know how to live if you first know where you are going. When we were born Muslims we probably began with the spiritual end in mind when we realized our need for salvation and obeyed the Lord's command to be baptized for the remission of our sins. We wanted to be sure that we pointed our spirits toward heaven. As we settled into living the Muslim life, however, we tended to lose sight of the end for which we were striving and settled into a comfortable accommodation with the world around us. We didn't want to be â€Å"preachy† and we didn't want to make waves about the spiritual condition or doctrinal status of other religious people. We didn't comment unfavorably about how the world violates God's will by its crime, delinquency and harmful habits. We became just so easy to live or work with. Prophet Mohammad said, â€Å"Inamal amalu bil niat† This means your acts are depended on your goals/niats. Covey said Begin with the End in Mind, the same thing which Prophet Mohammad said years ago. Or as another hadees proves that whatever we do today in this world; its ajur will be given to us when this world comes to an end; i.e.; â€Å"Dunya Aakhirat Kee Khaitee Hai† The comfort of Christianity may be deceiving though, because it goes against the experience of early Christians who found their lives to be somewhat of a struggle, Peter writes to Christians dispersed throughout the Mediterranean world and says that they â€Å"Have been distressed by various trials† (1Peter 1:6). James says, â€Å"Count it all joy, my brethren, when you encounter various trials, knowing that the testing of your faith produces endurance, and let endurance have its perfect result, that you may be perfect and complete, lacking in nothing† (James 1:3,4) Some of us who began with the end in mind may fall prey to an even more ominous danger posed by â€Å"Deceitful spirits and doctrines of demons, â€Å"the hypocrisy of liars seared in their own conscience as with a branding iron, men who forbid marriage and advocate abstaining from foods† (1 Timothy 4:1-3). It's easy to fall prey to people who strive to generate in us a desire for a new or novel approach to religion by decrying what they imply is a staid and stolid stance on Scripture as doctrine. They try to create in us the feeling that we are not as â€Å"spiritual† as they are because we insist on going by the Bible only at all times. Our struggle is going to be against arguments for preaching what is â€Å"politically correct† in the sense that it satisfies what the pollsters determine is â€Å"what people want.† Find out what people want, and give them that is the implied message of much that the â€Å"change agents† want to foist on the church. Our cry should be; â€Å"Sustain me according to Thy word, that I may live; and do not let me be ashamed of my hope† (Psalm 119: 116) we began with the end in mind – be saved and go to heaven. The devil is trying by every means to discourage us from keeping the end in mind. He is trying now to get the human kind to drop the Bible as their guide (â€Å"It's propositional truth,† he says) and listen to messages which are more comforting to all. He wants a trouble free religion for all, with no challenges, no stress, no trials, no temptations – but that will not lead to the end we had in mind at the beginning of our life. â€Å"But they will have to give account to him who is ready to judge the living and the dead. For this is the reason the gospel was preached even to those who are now dead, so that they might be judged according to men in regard to the body, but live according to God in regard to the spirit. The end of all things is near. Therefore be clear minded and self- controlled so that you can pray.† I Peter 4:5-7 My Point of View: As I watched David Beckham making his final winning shot, I realized that football provides some great analogies for life. Hundreds of moves and plays are required to reach the goal, yet it is impossible to plan each play before the game begins. The players can see the goal — to win the game — and they can predict what the next few plays will be, but they can't figure out the exact moves they will make by just standing on the sideline. They must take action and continuously look for their next few moves as they keep the goal in mind. They stay focused by remaining aware of where they are and what options are available to them. This sharp focus makes it possible to seize opportunities as they arise and ultimately win the game! During the game I overheard a friend ask, â€Å"Why is he running backwards with the ball? Isn't the goal the other direction?† My friend explained that the football player hoped to gain yards by running backwards, because he was creating space so he could throw a long pass. That's bigger picture thinking! How often do we plow forward with our next move without thinking about the bigger picture? Take a few minutes to jot down your response to these questions: > What are my most important goals or dreams for the coming year? > What would it look and feel like if I were already there? > How can I accomplish this with the greatest ease? Look through your wide-angle lens for the opportunities you may have previously missed. Be aware of where you are on your journey and what your next few moves will be. Then take action! Stephen Covey's second habit (Begin with the end in mind) will help you to move from dependence to independence. Procrastination! I know it well. From taxes to yard work to filing papers–you name it, I'm the expert procrastinator. I can put off doing anything, with style and ease. I file for college registration at the last minute without breaking a sweat. Am I proud of this? Well, admittedly, sometimes yes. I pat myself on the back and say â€Å"I have the amazing ability to get things done at the last minute.† Do I usually end up regretting my procrastination? Almost always. So I've had to learn ways to get things done now, on time. I'm still learning and always will be. Procrastination is a persistent thief! Procrastination is an expensive way to spend your life. Waiting until the last minute can even cost you your life. And when you â€Å"spend† your life mired in defering, you don't truly live. You are perpetually putting off living. There are numerous causes and explanations for procrastination, including, but not limited to: > Fear of success > Fear of the unknown > Lack of interest or motivation > Lack of information > Too much information > Indecision > Not knowing where to start > Too busy > Laziness I believe procrastination is one thing, which can be overcome by having an ulterior motive in life. In other words, get a clear vision in your mind (and on paper) of what you want, and where you want to be. This may seem contradictory to what I said about not worrying about tomorrow, but these two principles work hand-in-hand. By knowing clearly what you want to achieve, you can relax in the day-to-day details of accomplishing your goal. Secondly, being productive also means begin with the end in mind. Even for a simple meeting held to be successful one has to keep the end results derived from it in mind. Before you hold your meeting, you should know what you're trying to accomplish in the meeting and how you will know when you've actually achieved what you set out to achieve. In Simply Brilliant, Fergus O'Connell recounts the tale of a friend who writes down the minutes of the meeting before she actually holds the meeting. â€Å"Here's how I will know when the meeting has achieved it objectives,† says O'Connell's friend. Winners understand that success comes from a series of small steps that keep in mind their ultimate destination. We may have a dream and not know how or where to begin. If we map out how we will feel, think and act when we reach our goal, then Its time to begin building an internal kinesthetic sense of success. Each step reveals the next step. A series of steps, done with excellence and discernment, will lead us to our destination. Conclusion: Let's go back to the future†¦Imagine yourself reflecting on your life ten years from now. As you reflect, what is it you wish you had said or done? What vision is it that you wish you had been able-or willing-to articulate? Take some good advice from Stephen Covey: as you step up to the challenge of giving your life a meaning-you will make the best contribution if you â€Å"begin with the end in mind.† In summary, create and live by a personal mission statement. This may lead onto more specific goals and objectives, but the idea is that you try to live as the sort of person you'd like to be remembered for when you've passed on. â€Å"What lies behind us and what lies before us are tiny matters compared to what lies within us.† -Oliver Wendall Holmes Bibliography: > Seven Habits Of Effective People by Stephen Covey > Internet (Web Search from Altavista.com and Askjeeves.com) > Critical Analysis written by Michael Gray > Critical Analysis by Gary Vancil College of Business Management Begin With The End In Mind Page 1